The aim of anticoagulant/antithrombotic therapy in cardiovascular disease is to prevent fibrin deposition and platelet aggregation, halting current and future ischemic episodes. The limitations to the effectiveness of the most commonly used agents (heparin, coumadin and aspirin) have led to the development of new anticoagulant compounds. In particular, aptamers represent an attractive approach because of their high specificity and low immunogenicity. The best known example is the Thrombin Binding Aptamer (TBA), namely 5‘GGTTGGTGT-GGTTGG3’[1]. TBA and its derivatives [2] adopt a G-quadruplex structure [2-6] and inhibit thrombin activity by blocking the fibrinogen binding site (exosite I) [3-6]. Biological properties of TBA are strictly dependent on its tertiary structure. Other antithrombotic aptamers have been identified using the SELEX process and partially characterized. Among them HD22, namely 5’GTCCGTGGTAGGGCAGGTTGGGGTGAC3’, is particularly interesting. It presents a 15-nucleotide core sequence that has striking similarity to TBA, and it has been reported to adopt a mixed duplex/quadruplex structure [7]. Remarkably HD22 binds thrombin with much higher affinity than TBA and has been shown to bind exosite II instead of exosite I [7]. No structural data on thrombin-HD22 complex has been reported so far. We have solved the X-ray structure of the thrombin-HD22 complex, with the aim to understand the molecular details of the interaction between the two molecules and to investigate the differences with respect to thrombin-TBA complex, whose structure we have recently determined at high resolution. These results could help the design of a new class of aptamers with an improved capability to modulate thrombin function. [1] L.C. Bock, L.C. Griffin, J.A. Latham, E.H. Vermaas, J.J. Toole, Nature, 355, 1992, 564. [2] L. Martino, A. Virno, A. Randazzo, A. Virgilio, V. Esposito, C. Giancola, M. Bucci, G. Cirino, L. Mayol, NAR, 34, 2006, 6653. [3] R.F. Macaya, P. Schultze, F.W. Smith, J.A. Roe, J. Feigon, PNAS USA, 90, 1993, 3745. [4] K. Padmanabhan, A. Tulinsky, Acta Crystallogr. D, 52, 1996, 272. [5] I. Russo Krauss, A. Merlino, A. Randazzo, L. Mazzarella, F. Sica, Acta Crystallogr F, 66, 2010, 961. [6] I. Russo Krauss, A. Merlino, C. Giancola, A. Randazzo, L. Mazzarella, F. Sica NAR, submitted [7] D.M. Tasset, M.F. Kubik, W. Steiner, JMB, 272(5), 1997, 688.
The X-ray structural view of the complex between human alpha thrombin and a DNA aptamer directed to exosite II / RUSSO KRAUSS, I., A., P., Merlino, A., L., M., Sica, F.. - ELETTRONICO. - (2011), pp. 1109-1109. (XXIV Congresso Nazionale della Società Chimica Italiana Lecce 11-16 Settembre 2011).
The X-ray structural view of the complex between human alpha thrombin and a DNA aptamer directed to exosite II
RUSSO KRAUSS, IRENE;MERLINO, ANTONELLO;SICA, FILOMENA
2011
Abstract
The aim of anticoagulant/antithrombotic therapy in cardiovascular disease is to prevent fibrin deposition and platelet aggregation, halting current and future ischemic episodes. The limitations to the effectiveness of the most commonly used agents (heparin, coumadin and aspirin) have led to the development of new anticoagulant compounds. In particular, aptamers represent an attractive approach because of their high specificity and low immunogenicity. The best known example is the Thrombin Binding Aptamer (TBA), namely 5‘GGTTGGTGT-GGTTGG3’[1]. TBA and its derivatives [2] adopt a G-quadruplex structure [2-6] and inhibit thrombin activity by blocking the fibrinogen binding site (exosite I) [3-6]. Biological properties of TBA are strictly dependent on its tertiary structure. Other antithrombotic aptamers have been identified using the SELEX process and partially characterized. Among them HD22, namely 5’GTCCGTGGTAGGGCAGGTTGGGGTGAC3’, is particularly interesting. It presents a 15-nucleotide core sequence that has striking similarity to TBA, and it has been reported to adopt a mixed duplex/quadruplex structure [7]. Remarkably HD22 binds thrombin with much higher affinity than TBA and has been shown to bind exosite II instead of exosite I [7]. No structural data on thrombin-HD22 complex has been reported so far. We have solved the X-ray structure of the thrombin-HD22 complex, with the aim to understand the molecular details of the interaction between the two molecules and to investigate the differences with respect to thrombin-TBA complex, whose structure we have recently determined at high resolution. These results could help the design of a new class of aptamers with an improved capability to modulate thrombin function. [1] L.C. Bock, L.C. Griffin, J.A. Latham, E.H. Vermaas, J.J. Toole, Nature, 355, 1992, 564. [2] L. Martino, A. Virno, A. Randazzo, A. Virgilio, V. Esposito, C. Giancola, M. Bucci, G. Cirino, L. Mayol, NAR, 34, 2006, 6653. [3] R.F. Macaya, P. Schultze, F.W. Smith, J.A. Roe, J. Feigon, PNAS USA, 90, 1993, 3745. [4] K. Padmanabhan, A. Tulinsky, Acta Crystallogr. D, 52, 1996, 272. [5] I. Russo Krauss, A. Merlino, A. Randazzo, L. Mazzarella, F. Sica, Acta Crystallogr F, 66, 2010, 961. [6] I. Russo Krauss, A. Merlino, C. Giancola, A. Randazzo, L. Mazzarella, F. Sica NAR, submitted [7] D.M. Tasset, M.F. Kubik, W. Steiner, JMB, 272(5), 1997, 688.I documenti in IRIS sono protetti da copyright e tutti i diritti sono riservati, salvo diversa indicazione.


