Interferon gamma (IFNG) is a pro-inflammatory cytokine produced by different cells of the innate and adaptive immune system. It plays a critical role orchestrating the immune response towards many pathogens including virus and intracellular bacteria. Mycobacterium bovis, the causing agent of bovine tuberculosis (bTB), is an intracellular bacteria that is phagocytized by alveolar macrophages and stimulates production and secretion of IFNG. It has been demonstrated that polymorphisms in the Ifng gene affect the outcome of TB. For this reason, in this study we want to analyze the genetic variability in the Ifng gene and how the susceptibility to bovine tuberculosis in water buffalo (Bubalus bubalis) is influenced. To test our hypothesis, we have collected 184 blood samples from 5 different water buffalo herds in the Campania region (South Italy). Samples were first divided in cases (59 subjects) and controls (125 subjects) according to a previous study. We sequenced a fragment of 690 bp spanning the exon 4 of Ifng gene (NW_005783995.1) in 20 samples chosen randomly. Alignment analysis show a nucleotide transversion at the position g.4667G>A in the 3’ untraslated region (3’UTR). To verify if the g.4667G>A could have any potential regulatory effect on IFNG expression, we interrogated a software for prediction of microRNA (miR) binding site (http://www.targetscan.org/vert_71/). MicroRNA (miR) are short noncoding RNA that influence the gene expression targeting a seed sequence mostly located the 3’UTR of a specific gene. Thus, we found that our polymorphism belong to 5’ GGTTTTATCTCAGGGGCCAACTAGG 3’ that includes the seed sequence of miR-125b (seed sequence is underlined and the polymorphism g.4667G>A is highlighted in bold). This preliminary finding is a good starting point for extending the analysis of g.4667G>A to all 184 samples to verify if the polymorphism is associated with resistance to bovine tuberculosis in water buffalo. Moreover, functional in vitro studies will be performed to evaluate if the binding of miR-125b is influenced by the g.4667G>A in water buffalo.
Identification of a novel polymorphism in the 3’untraslated region of the interferon gamma gene as potential marker associate with bovine tuberculosis in water buffalo / Iannaccone, M., Papaianni, M., Ianello, F., Fulgione, A., Gallo, D., Cosenza, G., Capparelli, R.. - In: ITALIAN JOURNAL OF ANIMAL SCIENCE. - ISSN 1828-051X. - 16:s1(2017), pp. 78-78.
Identification of a novel polymorphism in the 3’untraslated region of the interferon gamma gene as potential marker associate with bovine tuberculosis in water buffalo
IANNACCONE, MARCO;Papaianni, Marina;FULGIONE, ANDREA;GALLO, DANIELA;COSENZA, GIANFRANCO;CAPPARELLI, ROSANNA
2017
Abstract
Interferon gamma (IFNG) is a pro-inflammatory cytokine produced by different cells of the innate and adaptive immune system. It plays a critical role orchestrating the immune response towards many pathogens including virus and intracellular bacteria. Mycobacterium bovis, the causing agent of bovine tuberculosis (bTB), is an intracellular bacteria that is phagocytized by alveolar macrophages and stimulates production and secretion of IFNG. It has been demonstrated that polymorphisms in the Ifng gene affect the outcome of TB. For this reason, in this study we want to analyze the genetic variability in the Ifng gene and how the susceptibility to bovine tuberculosis in water buffalo (Bubalus bubalis) is influenced. To test our hypothesis, we have collected 184 blood samples from 5 different water buffalo herds in the Campania region (South Italy). Samples were first divided in cases (59 subjects) and controls (125 subjects) according to a previous study. We sequenced a fragment of 690 bp spanning the exon 4 of Ifng gene (NW_005783995.1) in 20 samples chosen randomly. Alignment analysis show a nucleotide transversion at the position g.4667G>A in the 3’ untraslated region (3’UTR). To verify if the g.4667G>A could have any potential regulatory effect on IFNG expression, we interrogated a software for prediction of microRNA (miR) binding site (http://www.targetscan.org/vert_71/). MicroRNA (miR) are short noncoding RNA that influence the gene expression targeting a seed sequence mostly located the 3’UTR of a specific gene. Thus, we found that our polymorphism belong to 5’ GGTTTTATCTCAGGGGCCAACTAGG 3’ that includes the seed sequence of miR-125b (seed sequence is underlined and the polymorphism g.4667G>A is highlighted in bold). This preliminary finding is a good starting point for extending the analysis of g.4667G>A to all 184 samples to verify if the polymorphism is associated with resistance to bovine tuberculosis in water buffalo. Moreover, functional in vitro studies will be performed to evaluate if the binding of miR-125b is influenced by the g.4667G>A in water buffalo.I documenti in IRIS sono protetti da copyright e tutti i diritti sono riservati, salvo diversa indicazione.


