The ACACA enzyme catalyses the first committed step of fatty acid synthesis in mammalian cytosol, the carboxylation of acetyl-CoA to malonyl-CoA, leading to the biosynthesis of long-chain fatty acids. To our knowledge no information on DNA genetic variability at ACACA locus has been reported so far in buffalo species. Consequently, in order to detected polymorphisms at Italian Mediterranean river buffalo ACACA locus and test possible associations with milk yield, we analyzed 551 subjects belonging to 14 farms, located in Salerno and Caserta province. A total of 7096 records for milk yield measured monthly with an automatized milk recording system on 1096 lactations were used. The DNA regions of the ACACA gene spanning partial exons 1 of 10 individual samples, randomly chosen, were amplified and sequenced using primers (GACAGTTTCTGACCTTTTGGTG and AGACCTCTCTGCTTCCAA) designed on the genomic buffalo sequence (EMBL acc. no. NW_005785166). Sequences’comparison showed a transvertion C→T at position 34 of the exon 1 (5’ UTR) (NW_005785166:g4381303G>A). The genotyping of DNA samples was performed at the KBiosciences (http://www.kbioscience.co.uk) laboratory. The major allele had a relative frequency of 0.88 and the locus was in Hardy–Weinberg equilibrium. A mixed linear model procedure of SAS 9.1 (SAS Institute) was used for the association analysis between genotypes and milk yield. The model included fixed effects of the genotype, farm, calving season, days in milk, parity and the random effect of the animal. None of the three genotypes had significant associations with milk yield. In conclusion, in this study, we report the first SNP identification at the ACACA locus in Mediterranean river buffalo. Although we found no association between the detected polymorphism and milk yield, our work provides a starting point for studies of the future possible association between ACACA variation and other milk phenotypic traits in buffalo
First marker discovery in ACACA gene and association study with milk yield in Mediterranean river buffalo / Cosenza, Gianfranco; Ramunno, L.; Gallo, Daniela; Iannaccone, Marco; Capparelli, Rosanna; Gu, M.; Pauciullo, A.. - In: ITALIAN JOURNAL OF ANIMAL SCIENCE. - ISSN 1594-4077. - 16:s1(2017), pp. 148-148.
First marker discovery in ACACA gene and association study with milk yield in Mediterranean river buffalo
COSENZA, GIANFRANCO;GALLO, DANIELA;IANNACCONE, MARCO;CAPPARELLI, ROSANNA;
2017
Abstract
The ACACA enzyme catalyses the first committed step of fatty acid synthesis in mammalian cytosol, the carboxylation of acetyl-CoA to malonyl-CoA, leading to the biosynthesis of long-chain fatty acids. To our knowledge no information on DNA genetic variability at ACACA locus has been reported so far in buffalo species. Consequently, in order to detected polymorphisms at Italian Mediterranean river buffalo ACACA locus and test possible associations with milk yield, we analyzed 551 subjects belonging to 14 farms, located in Salerno and Caserta province. A total of 7096 records for milk yield measured monthly with an automatized milk recording system on 1096 lactations were used. The DNA regions of the ACACA gene spanning partial exons 1 of 10 individual samples, randomly chosen, were amplified and sequenced using primers (GACAGTTTCTGACCTTTTGGTG and AGACCTCTCTGCTTCCAA) designed on the genomic buffalo sequence (EMBL acc. no. NW_005785166). Sequences’comparison showed a transvertion C→T at position 34 of the exon 1 (5’ UTR) (NW_005785166:g4381303G>A). The genotyping of DNA samples was performed at the KBiosciences (http://www.kbioscience.co.uk) laboratory. The major allele had a relative frequency of 0.88 and the locus was in Hardy–Weinberg equilibrium. A mixed linear model procedure of SAS 9.1 (SAS Institute) was used for the association analysis between genotypes and milk yield. The model included fixed effects of the genotype, farm, calving season, days in milk, parity and the random effect of the animal. None of the three genotypes had significant associations with milk yield. In conclusion, in this study, we report the first SNP identification at the ACACA locus in Mediterranean river buffalo. Although we found no association between the detected polymorphism and milk yield, our work provides a starting point for studies of the future possible association between ACACA variation and other milk phenotypic traits in buffaloI documenti in IRIS sono protetti da copyright e tutti i diritti sono riservati, salvo diversa indicazione.
